IPB University Logo

SCIENTIFIC REPOSITORY

IPB University Scientific Repository collects, disseminates, and provides persistent and reliable access to the research and scholarship of faculty, staff, and students at IPB University

AI Repository
 
Building and Categories


      View Item 
      •   IPB Repository
      • Dissertations and Theses
      • Undergraduate Theses
      • UT - Faculty of Mathematics and Natural Sciences
      • UT - Biochemistry
      • View Item
      •   IPB Repository
      • Dissertations and Theses
      • Undergraduate Theses
      • UT - Faculty of Mathematics and Natural Sciences
      • UT - Biochemistry
      • View Item
      JavaScript is disabled for your browser. Some features of this site may not work without it.

      Desain Marka Sgrna-Knockout CRISPR/Cas9 In Silico Gen Laktat Dehidrogenase Clostridium thermocellum Untuk Meningkatkan Produksi Biohidrogen

      Thumbnail
      View/Open
      Cover (488.8Kb)
      Fullteks (1.304Mb)
      Lampiran (434.5Kb)
      Date
      2022
      Author
      Banurea, Panji Ilahi Halomoan
      Seno, Djarot Sasongko Hami
      Koerniati, Sri
      Metadata
      Show full item record
      Abstract
      Fermentasi gelap merupakan metode yang dapat digunakan untuk memproduksi hidrogen dari limbah biomassa menggunakan mikroba anaerobik. Selama proses fermentasi dihasilkan beberapa produk samping salah satunya yaitu asam laktat. Asam laktat merupakan asam organik yang pembentukannya dikatalis oleh L – laktat dehidrogenase (LDH). LDH pada tingkat gen diekspresikan oleh ldh. Keberadaan asam laktat dalam konsentrasi tinggi diduga dapat menghambat proses fermentasi dan mengurangi jumlah produksi hidrogen. Penelitian ini bertujuan mendesain RNA pemandu (sgRNA) untuk menghambat pembentukan asam laktat dengan melumpuhan gen ldh melalui rekayasa genom CRISPR/Cas9. Metode ini diawali dengan mendesain sgRNA berdasarkan coding sequence (CDS) menggunakan alat desain Geneious serta dievaluasi efiseinsinya. Selanjutnya, sgRNA dikontruksi ke plasmid menggunakan Benchling. sgRNA hasil desain yang diperoleh yaitu 5'AAGATAACGGAACCTGGCTG3' (20nt) dengan PAM 5’TGTCCAAA3’ (8nt). Sekuen sgRNA memiliki nilai off – target MIT dan CFD 100,jumlah GC 50% dan membentuk kodon stop pada sekeun target.
       
      Dark fermentation is a method that can use to produce hydrogen from waste biomass using anaerobic microbes. During the fermentation, several byproducts are produced, lactic acid is one of which. Lactic acid is an organic acid whose formation is catalyzed by L – lactic dehydrogenase (LDH). LDH on gene-level expressed by ldh. A high concentration of lactic acid is thought to inhibit fermentation and reduce the amount of hydrogen. This study aims to design a guide RNA (sgRNA) to inhibit the formation of lactic acid by inactivating ldh through CRISPR/Cas9. This method begins with designing the sgRNA using the Geneious design tool and evaluating its efficiency. Next, sgRNA constructs to plasmid using Benchling. The design sgRNA obtained is 5'AAGATAACGGAACCTGGCTG3' (20nt) with PAM 5'TGTCCAAA3' (8nt). The sgRNA sequence has an off-target value of MIT and CFD of 100, the number of GC is 50%, and forms a stop codon on the target sequence.
       
      URI
      http://repository.ipb.ac.id/handle/123456789/110672
      Collections
      • UT - Biochemistry [1470]

      Copyright © 2020 Library of IPB University
      All rights reserved
      Contact Us | Send Feedback
      Indonesia DSpace Group 
      IPB University Scientific Repository
      UIN Syarif Hidayatullah Institutional Repository
      Universitas Jember Digital Repository
        

       

      Browse

      All of IPB RepositoryCollectionsBy Issue DateAuthorsTitlesSubjectsThis CollectionBy Issue DateAuthorsTitlesSubjects

      My Account

      Login

      Application

      google store

      Copyright © 2020 Library of IPB University
      All rights reserved
      Contact Us | Send Feedback
      Indonesia DSpace Group 
      IPB University Scientific Repository
      UIN Syarif Hidayatullah Institutional Repository
      Universitas Jember Digital Repository