Molecular Markers Development that is Associated with Apomixis Characters and the Strength of Cell Wall Composed Yellow Latex Secretory Duct on Mangosteen (Garcinia mangostana L.).
Abstract
Mangosteen is one of the excellent export fruit commodity from Indonesia and well-known as Queen of Tropical Fruits. There are two current main development issues of mangosteen, which are apomixis and yellow latex secretion from the fruit caused by destruction of epithelial cell that form yellow latex secretory duct. Therefore, a research to study the aspects of apomixis and cell wall strength that form yellow latex secretory duct in mangosteen should be done. This research consisted of two main topics, the development of molecular marker that is associated with the apomixis characters in Garcinia and molecular marker that is associated with the cell wall strength characters that form yellow latex secretory duct in mangosteen. Mangosteen reproduces through apomixis mechanism. Apomixis is a naturally occurring mode of reproduction that results in embryo formation without the involvement of meiosis or fertilization of the egg. Seed-derived progeny of an apomictic plant is genetically identical to the maternal parent. In Garcinia, apomixis form is called as adventitious embryony, which is divided into obligate and facultative apomixis. Identification and characterization of those apomixis in Garcinia is important for conservation and utilization of Garcinia members. The development of specific molecular markers that associated with apomixis is necessary. The developed markers can then be used as a tool for identification, characterization and selection of Garcinia germplasms. The first part of this research aimed to develop molecular markers related to apomixis character. The DNA ampilication was carried out using primer developed by Ozias-akins et al. (1998) based on the sequence of Pennisetum DNA. The primer was used to amplify DNA from four Garcinia species, i.e. : Garcinia mangostana L., G. hambroniana Pierre., G. celebica L. and G. malacensis T. Anderson. The result showed that only G. hambroniana Pierre. DNA could be not amplified, while the others showed the ampilication band with the size of ± 480 bp. The BLAST sequence analysis of the PCR frgment showed that there was no homology with other DNA sequences in database. Three set of primers were then designed based on Single Nucleotide Polymorphism (SNP) among three DNA sequences from those three species (G. mangostana L., G. celebica L. and G. malacensis T. Anderson). This research succesfully developed three set of primers, which were (1) Apo_Fak1 (forward 5‟ACAATAATCACCACCATACC‟3 and reverse 5‟GTCTT TTCCACTTGGGCTGG‟3); (2); Apo_Fak2 (forward 5‟ACAATAATCACCA CCATACC‟3 and reverse 5‟AGGCTTCAACTTAGTTGTCA‟3); (3) Apo_Obli (forward 5‟ACAATAATCACCACCATACC‟3 and reverse 5‟TCATTTCCCA CTTGGGCTGT‟3). Those three set of primers were then verified using three reference species (G. mangostana L., G. celebica L. and G. malacensis T. Anderson) and the result showed two specific bands that related with apomixis character, i.e. : a 300 bp DNA band produced from G. mangostana L. and G. celebica L., while a 317 bp produced from G. malacensis T. Anderson. Forty one species of Garcinia can be separated into three groups based on the developed molecular markers. Fourteen species were identified as obligate apomixis, fourteen species were facultative apomixis with dioecius flowers, and the other thirteen species were facultative apomixis with hermaprodit flowers. Another aspect of mangosteen development that should be considered is how to eliminate yellow latex secretion from mangosteen fruit. Yellow latex is a major problem on mangosteen that could decrease fruit quality. The structure of yellow latex secretory ducts, which consist of big lumen, was surrounded by epithelial cells. The duct is canal-like form and branched. It is suggested that the destruction of epithelial cell that form yellow latex secretory duct caused yellow latex secretion. In mangosteen, yellow latex is often found in fruit aril. Since the yellow latex secretion character in mangosteen is largely influenced by environment, the breeding technique to develop free yellow latex fruit is quite difficult. The objective of the second part in this research was to develop a molecular marker that is associated with the fruit epithelial cell wall strength. The developed molecular marker which linked to cell wall strength character might be useful to identify mangosteen germplasm that potential as parent producing free yellow latex fruit. The marker could also be used in progeny selection in the mangosteen breeding program. Nested primers were designed based on the Fragile Fiber 1 (FRA 1) gene sequences. Among four developed primer combinations only one primer combination could produce specific band that could discriminate the yellow latex producing plant and free yellow latex plant. The DNA band was resequenced and used to design a new set of primer (forward 5‟CAAAGGAATGG GAGCATAAG‟3 and reverse 5‟AGCG GACCACATTTAGAGTG„3) that was used to develop a molecular marker related to cell wall strength. The molecular marker were named as KDSM. The verification of molecular marker using thirty nine accessions of mangosteen showed close relation between marker KDSM and yellow latex secretion character. In general plants that secreted yellow latex did not have DNA band, while the other one hand a 260 bp DNA band. Among thirty nine mangosteen accessions, twenty accessions that secreted yellow latex did not produce DNA band, while nineteen accessions that do not secreted yellow latex were divided into two groups. Sixteen accessions produce a 260 bp DNA band and three accessions did not produce DNA band.

