Identifikasi, patogenisitas bakteri dan pemanfaatan gen 16S-rRNA untuk deteksi penyakit ice-ice pada budidaya rumput laut (Kappaphycus alvarezii)

Date
2011Author
Aris, Muh.
Sukenda
Harris, Enang
Sukadi, M. Fatuchri
Yuhana, Munti
Metadata
Show full item recordAbstract
Ice-ice disease on seaweed aquaculture Kappaphycus alvarezii has a significant effect on decreasing production of seaweed. Decreasing rate of biomass and caragenan content have positive correlation with ice-ice infected thallus weight based on cohabitation test between healthy and infected thallus. Destruction of seaweed tissues occurred in accordance with incubation time of ice-ice disease. Several bacteria had been successfully isolated from infected seaweed thallus and identified using API 20 E and API NE 20 identification test. Isolate of Vibrio alginoliticus PNGK 1 had the higest pathogenicity compared to other species such as Pseudomonas cepacia, Flavobacterium meningosepticum, Pseudomonas diminuta and Plesiomonas shigelloides. V. alginoliticus was significantly display ice-ice symptoms on day 1 after challenge test with dose of 106 CFU/mL. Molecular characterization on V. alginoliticus showed that PNGK 1 isolate similar with V. alginoliticus strain CIFRI V-TSB1. DNA sequencing data of V. alginoliticus PNGK 1 was used as the base of specific primer design for rapid detection of bacteria on seaweed thallus. Results of specific primer design through Primer 3 Program for V. alginoliticus PNGK 1 were primer aSEFM-F ((5- CAGCCACACTGGAACTGAGA -3) and aSEFM-R (5- TTAGCCGGTGCTTCTTCTGT -3). Amplication of V. alginoliticus PNGK 1 DNA resulted in one amplicon 201 bp. Development of rapid detection method on the present of pathogenic bacteria (V. alginoliticus PNGK 1) on seaweed thallus was conducted with several steps optimation test on PCR temperature resulted that at annealing 60oC the DNA of V. alginoliticus PNGK 1 could be detected. Using specifity test and sensitivity with that specific primer it was found a band of 201 bp. This detection method for pathogenic bacteria could be applied for early detectionof asymptoutic ice-ice sea weed. Penyakit ice-ice menyerang sentra budidaya di beberapa negara produsen rumput laut seperti di Filipina, Malaysia dan Tanzania, yang berakibat penurunan produksi rumput laut hingga 70-100%. Gejala penyakit ice-ice umumnya ditandai dengan pemutihan di pangkal thallus, tengah dan ujung thallus muda, yang dahului perubahan warna thallus menjadi putih bening atau transparan. Pengelolaan budidaya rumput laut yang sehat dan bebas penyakit ice-ice merupakan komponen penting dalam peningkatan produksi rumput laut, sehingga diperlukan teknik deteksi penyakit ice-ice secara cepat dan akurat. Selama ini identifikasi dan deteksi bakteri patogen dilakukan berdasarkan pengamatan gejala klinis, riwayat kejadian penyakit di lokasi budidaya, karakteristik morfologi, fisiologi dan biokimia bakteri. Metode tersebut memiliki peran yang cukup penting sebagai studi awal, namun kurang dapat menentukan hubungan filogenetis bakteri dan ekspresinya sangat dipengaruhi oleh faktor lingkungan. Seiring dengan perkembangan teknologi dalam bidang kesehatan ikan, berbagai teknik identifikasi dan deteksi telah dikembangkan, namun kajian tentang penyakit ice-ice pada budidaya rumput laut belum mendapat perhatian yang serius sehingga kuantitas dan kualitas produksi rumput laut fluktuatif. Metode deteksi yang banyak dikembangkan saat ini adalah metode deteksi secara molekuler melalui analisis DNA genom yang berbasis teknik PCR. Pemanfaatan gen 16S-rRNA telah digunakan sebagai parameter sistematik sebagai penanda untuk identifikasi spesies bakteri. Oleh karena itu, beberapa tahap penelitian telah dilakukan, mengenai isolasi, identifikasi bakteri patogen yang menyebabkan penyakit ice-ice, mekanisme patogenisitas bakteri patogen penyebab penyakit ice-ice dan pemanfaatan sekuen gen 16S-rRNA untuk mendisain primer spesifik PCR dalam deteksi cepat dan akurat.
Collections
- DT - Fisheries [777]

