ANALISIS KERAGAMAN GENETIK KERBAU LOKAL (Bubalus bubalis) BERDASARKAN HAPLOTIPE DNA MITOKONDRIA

Abstract

Mitochondrial DNA analysis is often used to study genetic diversity and phylogenetic relationships of the population through maternal inheritance pattern. This study aimed to identify the genetic variation among local buffaloes based on mtDNA. A total of 44 blood samples were collected from four provinces respectively, namely Central Java (10 heads), Nusa West-East (12 heads), North Sumatra (10 heads) and Banten (12 heads). MtDNA genome was extracted using phenol-chloroform protocol and amplified by polymerase chain reaction (PCR) and cut with restriction enzymes(restriction fragment length polymorphisms/RFLP). Primers used in the Forward GCATACGCAATCTTACGATCA (AF22) and Revers GTAGCTGGACTTAACTGCAT (AF23). PCR products along the 1145 base pairs (bp) was cuted with four restriction enzymes, namely AluI HaeIII, HinfI and MspI. The results showed the existence of two mtDNA haplotypes. The first haplotype had a widespread distribution throughout the sampling area, whereas the second haplotype was only found in one sample of North Sumatra. Based on the presence or absence of the restriction sites of the two haplotypes, it was obtained the value of nucleotide diversity (π) of 0.17%. The calculation of genetic distance in the form of a dendrogram showed that the samples of buffalo which coming from Central Java, Nusa West-East and Banten were probably derived from a common ancestor (D = 0.0000). Similarly, samples of buffaloes from North Sumatra was closely related to the third area (D = 0.0061).