View Item 
      •   IPB Repository
      • Dissertations and Theses
      • Undergraduate Theses
      • UT - Faculty of Mathematics and Natural Sciences
      • UT - Biochemistry
      • View Item
      •   IPB Repository
      • Dissertations and Theses
      • Undergraduate Theses
      • UT - Faculty of Mathematics and Natural Sciences
      • UT - Biochemistry
      • View Item
      JavaScript is disabled for your browser. Some features of this site may not work without it.

      Desain Primer LAMP secara In Silico untuk Aplikasi Deteksi Gen Babi pada Produk Olahan Daging

      Thumbnail
      View/Open
      Cover (2.213Mb)
      Fullteks (3.836Mb)
      Lampiran (3.075Mb)
      Date
      2022
      Author
      Fithri, Salsabila Aida
      Suryani
      Desriani
      Metadata
      Show full item record
      Abstract
      Kasus pencemaran daging babi pada produk olahan daging meningkatkan isu pentingnya identifikasi kehalalan pangan. Salah satu metode identifikasi yang dapat digunakan yaitu loop-mediated isothermal amplification (LAMP). Tujuan penelitian ini adalah mendesain primer LAMP menggunakan DNA mitokondria babi pada gen 12S rRNA, 16S rRNA, dan sitokrom b secara in silico. Metode yang digunakan adalah preparasi sekuen, penentuan dan identifikasi daerah target desain primer, desain primer menggunakan Primer Explorer V5, identifikasi primer, dan uji spesifitas primer secara in silico. Hasil penelitian diperoleh set primer gen sitokrom b dengan urutan basa F3: CCACCCCATATTAAACCAGAA, B3: GGTTGTCCTCCA-ATTCATGTT, F2: CTACGCTATCTACGTTCAATTCC, F1c: AGGATGG-AGGCTACTAGGGCTAAC, B2: AGGTCTGCTACTAGTATTCAGA, B1c: TGCCCATACTACACACATCCAAACA, LB: ATTTCGACCACTAAGTC-AATGCCT memenuhi parameter ideal dan memiliki spesifitas terbaik sehingga dapat digunakan untuk uji lanjutan secara in vitro menggunakan metode LAMP.
       
      The cases of pork contamination in processed meat products raises the issue of the importance of identifying halal food. One of the identification methods that can be used is loop-mediated isothermal amplification (LAMP). The purpose of this study was to design a LAMP primer using pig mitochondrial DNA in the 12S rRNA, 16S rRNA, and cytochrome b genes in silico. The research steps consisted of sequence preparation, determination and identification of target region primer design, primer design using Primer Explorer V5, identification of primer and in silico primer specificity test. The results of the study obtained a primary set of cytochrome b genes with the order of bases F3 CCACCATATTAAACCAGAA, B3: GGTTGTCCTCCA-ATTCATGTT, F2: CTACGCTATCTACGTTCAATTCC, F1c: AGGATG-GAGGCTACTAGGGCTAAC, B2: AGGTCTGCTACTAGTATTCAGA, B1c: TGCCCATACTACACACATCCAAACA, LB: ATTTCGACCACTAA-GTCAATGCCT meets ideal parameters and has the best specificity so it can be used for advanced testing in vitro using the LAMP method.
       
      URI
      http://repository.ipb.ac.id/handle/123456789/112565
      Collections
      • UT - Biochemistry [1470]

      Copyright © 2020 Library of IPB University
      All rights reserved
      Contact Us | Send Feedback
      Indonesia DSpace Group 
      IPB University Scientific Repository
      UIN Syarif Hidayatullah Institutional Repository
      Universitas Jember Digital Repository
        

       

      Browse

      All of IPB RepositoryCollectionsBy Issue DateAuthorsTitlesSubjectsThis CollectionBy Issue DateAuthorsTitlesSubjects

      My Account

      Login

      Application

      google store

      Copyright © 2020 Library of IPB University
      All rights reserved
      Contact Us | Send Feedback
      Indonesia DSpace Group 
      IPB University Scientific Repository
      UIN Syarif Hidayatullah Institutional Repository
      Universitas Jember Digital Repository