Please use this identifier to cite or link to this item:
http://repository.ipb.ac.id/handle/123456789/112565Full metadata record
| DC Field | Value | Language |
|---|---|---|
| dc.contributor.advisor | Suryani | - |
| dc.contributor.advisor | Desriani | - |
| dc.contributor.author | Fithri, Salsabila Aida | - |
| dc.date.accessioned | 2022-07-18T03:18:29Z | - |
| dc.date.available | 2022-07-18T03:18:29Z | - |
| dc.date.issued | 2022 | - |
| dc.identifier.uri | http://repository.ipb.ac.id/handle/123456789/112565 | - |
| dc.description.abstract | Kasus pencemaran daging babi pada produk olahan daging meningkatkan isu pentingnya identifikasi kehalalan pangan. Salah satu metode identifikasi yang dapat digunakan yaitu loop-mediated isothermal amplification (LAMP). Tujuan penelitian ini adalah mendesain primer LAMP menggunakan DNA mitokondria babi pada gen 12S rRNA, 16S rRNA, dan sitokrom b secara in silico. Metode yang digunakan adalah preparasi sekuen, penentuan dan identifikasi daerah target desain primer, desain primer menggunakan Primer Explorer V5, identifikasi primer, dan uji spesifitas primer secara in silico. Hasil penelitian diperoleh set primer gen sitokrom b dengan urutan basa F3: CCACCCCATATTAAACCAGAA, B3: GGTTGTCCTCCA-ATTCATGTT, F2: CTACGCTATCTACGTTCAATTCC, F1c: AGGATGG-AGGCTACTAGGGCTAAC, B2: AGGTCTGCTACTAGTATTCAGA, B1c: TGCCCATACTACACACATCCAAACA, LB: ATTTCGACCACTAAGTC-AATGCCT memenuhi parameter ideal dan memiliki spesifitas terbaik sehingga dapat digunakan untuk uji lanjutan secara in vitro menggunakan metode LAMP. | id |
| dc.description.abstract | The cases of pork contamination in processed meat products raises the issue of the importance of identifying halal food. One of the identification methods that can be used is loop-mediated isothermal amplification (LAMP). The purpose of this study was to design a LAMP primer using pig mitochondrial DNA in the 12S rRNA, 16S rRNA, and cytochrome b genes in silico. The research steps consisted of sequence preparation, determination and identification of target region primer design, primer design using Primer Explorer V5, identification of primer and in silico primer specificity test. The results of the study obtained a primary set of cytochrome b genes with the order of bases F3 CCACCATATTAAACCAGAA, B3: GGTTGTCCTCCA-ATTCATGTT, F2: CTACGCTATCTACGTTCAATTCC, F1c: AGGATG-GAGGCTACTAGGGCTAAC, B2: AGGTCTGCTACTAGTATTCAGA, B1c: TGCCCATACTACACACATCCAAACA, LB: ATTTCGACCACTAA-GTCAATGCCT meets ideal parameters and has the best specificity so it can be used for advanced testing in vitro using the LAMP method. | id |
| dc.language.iso | id | id |
| dc.publisher | IPB University | id |
| dc.title | Desain Primer LAMP secara In Silico untuk Aplikasi Deteksi Gen Babi pada Produk Olahan Daging | id |
| dc.title.alternative | In Silico LAMP Primer Design for Pig Gene Detection Applications in Processed Meat Products | id |
| dc.type | Undergraduate Thesis | id |
| dc.subject.keyword | 12S rRNA | id |
| dc.subject.keyword | 16S rRNA | id |
| dc.subject.keyword | cytochrome b | id |
| dc.subject.keyword | LAMP | id |
| dc.subject.keyword | processed meat products | id |
| Appears in Collections: | UT - Biochemistry | |
Files in This Item:
| File | Description | Size | Format | |
|---|---|---|---|---|
| G84180043-Salsabila Aida Fithri-Cover.pdf Restricted Access | Cover | 2.27 MB | Adobe PDF | View/Open |
| G84180043-Salsabila Aida Fithri.pdf Restricted Access | Fullteks | 3.93 MB | Adobe PDF | View/Open |
| G84180043-Salsabila Aida Fithri-Lampiran.pdf Restricted Access | Lampiran | 3.15 MB | Adobe PDF | View/Open |
Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.