Identifikasi carnation mottle virus pada tanaman anyelir (Dianthus Caryophyllus L.) melalui reverse transcription- polymerase chain reaction dan sekuen nukleotida

Abstract

A survey conducted in carnation (Dianthus caryophyllus L.) cultivation areas of Cianjur and Bandung, West Java found some plants showing mottle symptoms on the leaves. These virus-like induced symptoms were characterized by yellowing mottle on the leaves, dark green colour on the veins, slightly curved of the leaf edges. This study aimed to identify the virus causing mottle disease on carnation plants by reverse transcription-polymerase chain reaction (RT-PCR) method and nucleotide sequence analysis. The virus was successfully detected by RT-PCR using specific primers for the genus Carmovirus BC57 (5 'GATCGC GATGAATCCCACTGTGC 3') and BC58 (5 'TCACATCCTATAAACAACCA TTG 3') that amplified coat protein gene. The RT-PCRs amplified DNA fragments of Carmovirus about 1000 bp, a size in accordance with primer design. The RT-PCR products were then successfully sequenced. The alignment of nucleotide sequences indicated that the virus isolates were Carnation mottle virus (CarMV). Phylogenetic analysis showed that CarMV isolates from Indonesia have close evolutionary relationship with those of from Brazil, Israel, Iran, India, Netherland, and Spain.

Survei yang dilakukan di daerah pertanaman anyelir (Dianthus caryphyllus L.) di Cianjur dan Bandung, Jawa Barat menemukan beberapa tanaman yang menunjukan gejala belang pada daun. Gejala yang seperti diinduksi oleh virus ini ditandai dengan belang berwarna kuning pada daun, tulang daun menjadi berwarna hijau tua, dan tepi daun sedikit melekuk. Penelitian ini bertujuan untuk mengidentifikasi virus penyebab penyakit belang pada tanaman anyelir dengan menggunakan teknik Reverse Transcription-Polymerase Chain Reaction (RTPCR) dan analisis sekuen nukleotida. Virus ini berhasil dideteksi dengan RT-PCR menggunakan primer spesifik untuk genus Carmovirus (5 'GATCGCGATGA ATCCCACTGTGC3') dan BC58 (5 'TCACATCCTATAAACAACCATTG 3'). RT-PCR berhasil mengamplifikasi fragmen DNA Carmovirus pada daerah gen coat protein dengan ukuran sebesar 1000 bp sesuai dengan desain primer. Produk PCR telah berhasil disekuen. Penjajaran sekuen nukleotida mengindikasikan bahwa isolat virus yang berasosiasi dengan penyakit belang di Jawa Barat adalah Carnation mottle virus (CarMV). Analisis filogenetika menunjukkan bahwa isolat CarMV asal Indonesia memiliki hubungan kekerabatan yang dekat dengan isolat CarMV asal Belanda, Brazil, India, Iran, Israel, dan Spanyol.