Show simple item record

dc.contributor.authorMurtini, Sri
dc.contributor.authorR.Susanti
dc.contributor.authorHandharyani, Ekowati
dc.date.accessioned2014-12-16T07:59:15Z
dc.date.available2014-12-16T07:59:15Z
dc.date.issued2009
dc.identifier.citationJurnal Ilmu Pertanian Indonesia, April 2009, hlm. 15-22 Vol. 14 No.1en
dc.identifier.issn0853 – 4217
dc.identifier.urihttp://repository.ipb.ac.id/handle/123456789/71708
dc.description.abstractHighly pathogenic avian influenza (HPAI) H5N1 virus is a known pathogen in birds. Recently, the virus has been reported to cause sporadic fatal disease in tigers, leopards, and other exotic felids as well as domestic cats in Thailand. The present study was carried out to investigate the presence of AI H5N1 virus infection in stray cats roaming around residential, traditional and chicken farms in Bogor, West Java. Ninety serum samples were tested using HI test to screened for the presence of antibody to AI H5N1. Virus isolation was done in SPF embrionated chicken eggs and identify using HI, AGP and RT-PCR. The results showed that 18,9% of stray cats developed antibodies against H5 with geometric mean titre 23,1 . Stray cats lived in traditional markets 18–40% developed antibodies in the titre ranging from 22,8 to 24,5. Only two out of nine stray cats which lived in chicken farm developed low antibody titres again H5 (21). None of the stray cats lived in residencial area have developed antibodies against H5. This study revealed that stray cats have been contact with AI H5. Avian influenza H5 viruses were isolated in eight out of 33 pooled of rectal swab samples. The viral cleavage site sequences are CCTCAAAGAGAGAGC AGAAGAAAGAAGAGAGGT which represent amino acid sequences of PQRESRRKKRG. Based on the cleavage site sequence, the isolates are similar with the AI H5 virus subtype isolated from human in Indonesia during 2005–2007.en
dc.description.abstractPenelitian ini dilakukan untuk mengetahui status serologis dan keberadaan virus AI pada kucing jalanan di kota Bogor. Sebanyak 90 contoh serum dan usap rektal diambil dari kucing jalanan yang berkeliaran di sekitar pasar tradisional, lingkungan pemukiman, serta peternakan ayam di daerah Bogor. Uji penghambatan aglutinasi (HI) dilakukan untuk mendeteksi adanya antibodi anti H5N1. Keberadaan virus diperiksa dari contoh usap rektaldan dilakukan isolasi virusnya. virus diisolasi pada telur ayam berembrio bebas patogen tertentu (SPF) dan diidentifikasi dengan uji HI dan AGPT serta RT-PCR. Seroprevalensi virus AI H5N1 pada kucing di Bogor sebesar 18,9% dengan rataan titer antibodi log 23,1 yang menunjukan adanya paparan virus AI pada kucing. Tingkat keterpaparan kucing asal pasar tradisional berkisar antara 18–40% dengan rataan titer antibodi antara log 22,8– 24,5, rataan tertinggi terjadi pada serum asal kucing di Pasar Gunung Batu dan terendah di Pasar Baru Bogor. Tingkat keterpaparan kucing yang hidup di sekitar peternakan yang diperiksa 22,2% dengan rataan titer antibodi log 21. Tidak ditemukan adanya adanya antibodi anti AI H5N1 pada serum kucing jalanan di wilayah pemukiman. Hasil isolasi virus a ditemukan delapan isolat virus AI H5N1. Hasil sekuensing menunjukan bahwa isolat-isolat virus asal kucing ini secara molekuler memiliki cleavage site dengan urutan CCTCAAAGAGAGAGCAGAAGAAAGAAGAGAGGT dengan urutan asam aminonya PQRESRRKKRG. Berdasarkan sekuen gen dan asam amino daerah clevage sitenya isolat-isolat asal kucing liar/jalanan di Bogor ini termasuk dalam golongan virus HPAI dan mempunyai struktur yang sama dengan isolat asal manusia di Indonesia tahun 2005–2007.en
dc.language.isoid
dc.titleSerologi dan virologi virus avian influenza h5n1 pada kucing jalanan di Kota Bogoren
dc.title.alternativeSerological and virological study of avian influenza h5n1 in stray cats in Bogoren
dc.typeArticleen
dc.typeBooken
dc.subject.keywordcat,en
dc.subject.keywordavian influenza,en
dc.subject.keywordHPAI.en


Files in this item

Thumbnail
Thumbnail

This item appears in the following Collection(s)

Show simple item record